This page allows you to input Primer/Probe sequences to check how well they are conserved across a large collection of clinical isolates.
Primer conservation

Please input your primer/probe sequences and hit submit. Only standard IUPAC symbols may be used.

For example you can try with these sequences:

Forward: CCCTGTGGGTTTTACACTTAA, Reverse: ACGATTGTGCATCAGCTGA and Probe: CCGTCTGCGGTATGTGGAAAGGTTATGG